TABLE 6.

Primers for fingerprinting of E. histolytica, E. dispar, and E. moshkovskii

Gene targetPrimerSequence (5′→3′)Reference(s)
Strain-specific gene for E. histolyticaSSG5GGTCTCAAAAAACCCACGAG33, 213
SSG3CAAACGATAAAATCTAGCAAACTAC
Serine gene for E. histolyticaSREHP5 (EHF)GCTAGTCCTGAAAAGCTTGAAGAAGCTG11, 33, 69, 146, 170, 213
SREPH3 (EHR)GGACTTGATGCAGCATCAAGGT
nSREPH5TATTATTATCGTTATCTGAACTACTTCCTG
nSREPH3TGAAGATAATGAAGATGATGAAGATG
Serine gene for E. disparSREHP (F) EDFAGATACTAAGATTTCAGTC62
SREHP (R) EDRCATAATGAAAGCAAAGAG
Chitinase gene for E. histolyticaEHFGGAACACCAGGTAAATGTATA62, 69
EHRTCTGTATTGTGCCCAATT
Chitinase gene for E. disparEDFGGAACACCAGGTAAATGCCTT62
EDRTCTGTATTGTGCCCAATT
Intergenic regions between actin geneEH/EDFTTGGTGGAATGTAGTCAACTG62
    and superoxide dismutase gene of E. histolytica and E. disparEH/EDRAAATCCGGCTTTACACATTCC
Locus 1-2 (E. histolytica and E. dispar)Dsp1TTGAAGAGTTCACTTTTTATACTATA136, 211, 212
Dsp2TAACAATAAAGGGGAGGG
Locus 5-6 (E. histolytica and E. dispar)Dsp5CTATACTATATTCTT TTTATGTACTTCCC
Dsp6CTGAGAGCATTGTTTTTAAAGAA
E. moshkovskii Arg geneEmR-1GGCGCCTTTTTTACTTTATGG8
EmR-2GCTAACAAGGCCAATCGATAAA