TABLE 4.

Primers used for conventional PCR for E. histolytica, E. dispar, and E. moshkovskii

PCR assayGene targetAmplification product (bp)PrimersSequence (5′→3′)Reference(s)
Single tubeM17482P1-S17aGCAACTAGTGTTAGTTA63, 187, 214
P1-AS20aCCTCCAAGATATGTTTTAAC
30-kDa protein100P11aGGAGGAGTAGGAAAGTTGAC69, 119, 135, 146, 147,
P12aTTCTTGCAATTCCTGCTTCGA    148, 157, 179, 181, 182, 183, 214, 216
101P13bAGGAGGAGTAGGAAAATTAGG
P14bTTCTTGAAACTCCTGTTTCTAC
DNA highly repetitive sequences145EHP1aTCAAAATGGTCGTCGTCTAGGC151
EHP2aCAGTTAGAAATTATTGTACTTTGTA
133EHNP1bGGATCCTCCAAAAAATAAAGT
EHNP2bCCACAGAACGATATTGGATACC
Small-subunit rRNA876Psp FaGGCCAATTCATTCAATGAATTGAG32, 105, 106, 116, 117
Psp RaCTCAGATCTAGAAACAATGCTTCTC    118, 119, 141, 142, 196
NPspFbGGCCAATTTATGTAAGTAAATTGAG
NPspRbCTTGGATTTAGAAACAATGTTTCTTC
Extrachromosomal circular DNA145P1aTCAAAATGGTCGTCGTCTAGGC3, 6, 24, 214
P2aCAGTTAGAAATTATTGTACTTTGTA
133NP1bGGATCCTCCAAAAAATAAAGTTT
NP2bATGATCCATAGGTTATAGCAAGACA
Small-subunit rRNA1,950RD5cGGAAGCTTATCTGGTTGATCCTGCCAGTA141, 214
RD3cGGGATCCTGATCCTTCCGCAGGTTCACCTAC
Small-subunit rRNA880Eh5aGTACAAAATGGCCAATTCATTCAATG82, 192
Eh3aCTCAGATCTAGAAACAATGCTTCTCT
880Ed5bGTACAAAGTGGCCAATTTATGTAAGT
Ed5bACTTGGATTTAGAAACAATGTTTCTTC
Hemolysin gene (HLY6) LSU rRNA256EH6FaGACCTCTCCTAATATCCTCGT216
Eh6RaGCAGAGAAGTACTGTGAAGG
30-kDa protein374HFcAAGAAATTGATATTAATGAATATA86
HRcATCTTCCAATTCCATCATCAT
Duplex single stepCysteine proteinase242Ehcp6FaGTTGCTGCTGAAGAAACTTG54
Ehcp6RaGTACCATAACCAACTACTGC
Actin gene300Act3FcGGGACGATATGGAAAAGATC
Act5RcCAAGTCTAAGAATAGCA TGTG
NestedSmall-subunit rRNA135EH1aGTACAAAATGGCCAATTCATTCAATG27, 65
ED1bTACAAAGTGGCCAATTTATGTAAGTA
EHD 2cACTACCAACTGATTGATAGATCAG
Small-subunit rRNA900EH-1cTTTGTATTAGTACAAA11, 72, 97, 214, 216
EH-2cGTA(A/G)TATTGATATACT
900EHP-1aAATGGCCAATTCATTCAATG
EHP-2aTCTAGAAACAATGCTTCTCT
900EHN-1bAGTGGCCAATTTATGTAAGT
EHN-2bTTTAGAAACAATGTTTCTTC
Small-subunit rRNA1,076E1cTGCTGTGATTAAAACGCT50, 51, 129
E2cTTAACTATTTCAATCTCGG
427Eh-LaACATTTTGAAGACTTTATGTAAGTA
Eh-RaCAGATCTAGAAACAATGCTTCTCT
195Ed-LbGTTAGTTATCTAATTTCGATTAGAA
Ed-RbACACCACTTACTATCCCTACC
Small-subunit rRNA823Outer 1FcGAAATTCAGATGTACAAAGA89
Outer 1RcCAGAATCCTAGAATTTCAC
447Eh1aAAGCATTGTTTCTAGATCTG
Eh2aCACGTTAAAAGAGGTCTAAC
603Ed1bAAACATTGTTTCTAAATCCA
Ed2bACCACTTACTATCCCTACC
553SRPEh FCCTGAAAAGCTTGAAGAAGCTG141
SRPEh RcAACAATGAATGGACTTGATGCA
452nSRPEh FaTGAAGATAATGAAGATGATGAAGATG
nSRPEh RaTATTATTATCGTTATCTGAACTACTTCCTG
567SRPEd FbGTAGTTCATCAAACACAGGTGA
SRPEd RbCAATAGCCATAATGAAAGCAA
Small-subunit rRNA260Em-1dCTCTTCACGGGGAGTGCG8, 52, 130, 171
Em-2dTCGTTAGTTTCATTACCT
nEm-1dGAATAAGGATGGTATGAC
nEm-2dAAGTGGAGTTAACCACCT
MultiplexSmall-subunit rRNA166EntaFdATGCACGAGAGCGAAAGCAT71
752EhrdGATCTAGAAACAATGCTTCTCT
580EdrdCACCACTTACTATCCCTACC
EmrdTGACCGGAGCCAGAGACAT
Tandem repeats in132EhP1aCGATTTTCCCAGTTAGAAATTA123
    extrachromosomal circular rDNAEhP2aCAAAATGGTCGTCGTCTAGGC
96EdP1bATGGTGAGGTTGTAGCAGAGA
EdP2bCGATATTGGATACCTAGTACT
  • a Specific for E. histolytica.

  • b Specific for E. dispar.

  • c Specific for E. histolytica and E. dispar.

  • d Specific for E. moshkovskii.