TABLE 7.

PCR primers for the detection of β-lactamasesa

Enzyme familyPrimerbPrimer sequence (5′-3′)GenBank accession no.Nucleotide positions (in GenBank)Fragment size (bp)Entire coding regioncReference
Class A carbapenemases
    NMCNMC1*GCATTGATATACCTTTAGCAGAGAZ2195668-1912,158Yes 181
NMC4CGGTGATAAAATCACACTGAGCATA2225-2201
    SMEIRS-5AGATAGTAAATTTTATAGZ289685-221,138Yes 179
IRS-6CTCTAACGCTAATAG1142-1128
    IMIIMI-AATAGCCATCCTTGTTTAGCTC U50278 1291-1310No 9
IMI-BTCTGCGATTACTTTATCCTC2108-2089818
    KPCKPC forwardATGTCACTGTATCGCCGTCT AF297554 131-150893Yes* 13
KPC reverseTTTTCAGAGCCTTACTGCCC1023-1004
    GESGES-CGTTTTGCAATGTGCTCAACG AF326355 176-195371No 230
GES-DTGCCATAGCAATAGGCGTAG527-546
Class D oxacillinases
    Subgroup 1 (OXA-23)P5AAGCATGATGAGCGCAAAG AJ132105 785-8031,066Yes 41
P6AAAAGGCCCATTTATCTCAAA1850-1830
    Subgroup 2 (OXA-24)ForwardGTACTAATCAAAGTTGTGAA 3
ReverseTTCCCCTAACATGAATTTGT1023Yes
    Subgroup 3 (OXA-69)OXA-69ACTAATAATTGATCTACTCAAG AY859527 Primers external to GenBank sequence975Yes 69
OXA-69BCCAGTGGATGGATGGATAGATTATC
    Subgroup 4 (OXA-58)Pre-OXA-58prom+TTATCAAAATCCAATCGGC AY570763 72-90934Yes 68
PreOXA-58BTAACCTCAAACTTCTAATTC1005-986
    Subgroup 5 (Shewanella OXA-55)OXA-55/1CATCTACCTTTAAAATTCCC AY343493 Primers external to GenBank sequenceYes 71
OXA-55/2AGCTGTTCCTGCTTGAGCAC969-917
    Subgroup 6 (OXA-48)OXA-48ATTGGTGGCATCGATTATCGG AY236073 2218-2237744No 167
OXA-48BGAGCACTTCTTTTGTGATGGC2961-2941
    Subgroup 7 (OXA-50)SAATCCGGCGCTCATCCATCAE004091869Yes 56
ASGGTCGGCGACTGAGGCGG
    Subgroup 8 (OXA-60)OXA-60 AAAAGGAGTTGTCTCATGCTGTCTCG AF525303 2757-2782 57
OXA-60 BAACCTACAGGCGCGCGTCTCACGGTG3605-3579Yes
Multiplex PCR for OXAs in A. baumanniiOXA-51-likeTAATGCTTTGATCGGCCTTG353 232
TGGATTGCACTTCATCTTGG
OXA-23-likeGATCGGATTGGAGAACCAGA501
ATTTCTGACCGCATTTCCAT
OXA-24-likeGGTTAGTTGGCCCCCTTAAA246
AGTTGAGCGAAAAGGGGATT
OXA-58-likeAAGTATTGGGGCTTGTGCTG599
CCCCTCTGCGCTCTACATAC
Class B metalloenzymes
    IMP-1ForwardTGAGCAAGTTATCTGTATTC740Yes* 240
ReverseTTAGTTGCTTGGTTTTGATG
    IMP-2ForwardGGCAGTCGCCCTAAAACAAA737Yes 240
ReverseTAGTTACTTGGCTGTGATGG
    VIM-1ForwardTTATGGAGCAGCAACCGATGT920Yes 240
ReverseCAAAAGTCCCGCTCCAACGA
    VIM-2ForwardAAAGTTATGCCGCACTCACC865Yes 240
ReverseTGCAACTTCATGTTATGCCG
    SPM-1SPM-1FCCTACAATCTAACGGCGACC AJ492820 514-533650No 26
SPM-1RTCGCCGTGTCCAGGTATAAC1163-1143
    GIM-1GIM-1FAGAACCTTGACCGAACGCAG AJ620678 837-856748No 26
GIM-1RACTCATGACTCCTCACGAGG1584-1565
    SIM-1SIM1-FTACAAGGGATTCGGCATCG AY887066 620-638571No 104
SIM1-RTAATGGCCTGTTCCCATGTG1190-1171
Integron PCR5′ CSGGCATCCAAGCAGCAAGM738191190-1206Variable 106
3′ CSAAGCAGACTTGACCTGA
  • a Some primers are outside the coding regions and amplify the entire β-lactamase gene, as indicated; others are internal fragments for diagnostic purposes.

  • b *, NMC primers also amplify NMC-R. Where primers are designated “forward” and “reverse,” they were not given names in the referenced study.

  • c “Yes” indicates that entire coding region is amplified; “No” indicates that only a part of the coding region is amplified. *, primers cover the extreme ends of the protein.