TABLE 7.

PCR primers for the detection of β-lactamasesa

Enzyme familyPrimerbPrimer sequence (5′-3′)GenBank accession no.Nucleotide positions (in GenBank)Fragment size (bp)Entire coding regioncReference
Class A carbapenemases
    NMCNMC1*GCATTGATATACCTTTAGCAGAGAZ2195668-1912,158Yes181
NMC4CGGTGATAAAATCACACTGAGCATA2225-2201
    SMEIRS-5AGATAGTAAATTTTATAGZ289685-221,138Yes179
IRS-6CTCTAACGCTAATAG1142-1128
    IMIIMI-AATAGCCATCCTTGTTTAGCTCU502781291-1310No9
IMI-BTCTGCGATTACTTTATCCTC2108-2089818
    KPCKPC forwardATGTCACTGTATCGCCGTCTAF297554131-150893Yes*13
KPC reverseTTTTCAGAGCCTTACTGCCC1023-1004
    GESGES-CGTTTTGCAATGTGCTCAACGAF326355176-195371No230
GES-DTGCCATAGCAATAGGCGTAG527-546
Class D oxacillinases
    Subgroup 1 (OXA-23)P5AAGCATGATGAGCGCAAAGAJ132105785-8031,066Yes41
P6AAAAGGCCCATTTATCTCAAA1850-1830
    Subgroup 2 (OXA-24)ForwardGTACTAATCAAAGTTGTGAA3
ReverseTTCCCCTAACATGAATTTGT1023Yes
    Subgroup 3 (OXA-69)OXA-69ACTAATAATTGATCTACTCAAGAY859527Primers external to GenBank sequence975Yes69
OXA-69BCCAGTGGATGGATGGATAGATTATC
    Subgroup 4 (OXA-58)Pre-OXA-58prom+TTATCAAAATCCAATCGGCAY57076372-90934Yes68
PreOXA-58BTAACCTCAAACTTCTAATTC1005-986
    Subgroup 5 (Shewanella OXA-55)OXA-55/1CATCTACCTTTAAAATTCCCAY343493Primers external to GenBank sequenceYes71
OXA-55/2AGCTGTTCCTGCTTGAGCAC969-917
    Subgroup 6 (OXA-48)OXA-48ATTGGTGGCATCGATTATCGGAY2360732218-2237744No167
OXA-48BGAGCACTTCTTTTGTGATGGC2961-2941
    Subgroup 7 (OXA-50)SAATCCGGCGCTCATCCATCAE004091869Yes56
ASGGTCGGCGACTGAGGCGG
    Subgroup 8 (OXA-60)OXA-60 AAAAGGAGTTGTCTCATGCTGTCTCGAF5253032757-278257
OXA-60 BAACCTACAGGCGCGCGTCTCACGGTG3605-3579Yes
Multiplex PCR for OXAs in A. baumanniiOXA-51-likeTAATGCTTTGATCGGCCTTG353232
TGGATTGCACTTCATCTTGG
OXA-23-likeGATCGGATTGGAGAACCAGA501
ATTTCTGACCGCATTTCCAT
OXA-24-likeGGTTAGTTGGCCCCCTTAAA246
AGTTGAGCGAAAAGGGGATT
OXA-58-likeAAGTATTGGGGCTTGTGCTG599
CCCCTCTGCGCTCTACATAC
Class B metalloenzymes
    IMP-1ForwardTGAGCAAGTTATCTGTATTC740Yes*240
ReverseTTAGTTGCTTGGTTTTGATG
    IMP-2ForwardGGCAGTCGCCCTAAAACAAA737Yes240
ReverseTAGTTACTTGGCTGTGATGG
    VIM-1ForwardTTATGGAGCAGCAACCGATGT920Yes240
ReverseCAAAAGTCCCGCTCCAACGA
    VIM-2ForwardAAAGTTATGCCGCACTCACC865Yes240
ReverseTGCAACTTCATGTTATGCCG
    SPM-1SPM-1FCCTACAATCTAACGGCGACCAJ492820514-533650No26
SPM-1RTCGCCGTGTCCAGGTATAAC1163-1143
    GIM-1GIM-1FAGAACCTTGACCGAACGCAGAJ620678837-856748No26
GIM-1RACTCATGACTCCTCACGAGG1584-1565
    SIM-1SIM1-FTACAAGGGATTCGGCATCGAY887066620-638571No104
SIM1-RTAATGGCCTGTTCCCATGTG1190-1171
Integron PCR5′ CSGGCATCCAAGCAGCAAGM738191190-1206Variable106
3′ CSAAGCAGACTTGACCTGA
  • a Some primers are outside the coding regions and amplify the entire β-lactamase gene, as indicated; others are internal fragments for diagnostic purposes.

  • b *, NMC primers also amplify NMC-R. Where primers are designated “forward” and “reverse,” they were not given names in the referenced study.

  • c “Yes” indicates that entire coding region is amplified; “No” indicates that only a part of the coding region is amplified. *, primers cover the extreme ends of the protein.