Table 2.

Nucleotide sequences of PCR oligonucleotide primers and oligonucleotide probes for diarrheagenic E. coli strains

CategoryFactorPCR oligonucleotidesaReferenceOligonucleotide probeReference
ETECSTITTAATAGCACCCGGTACAAGCAGG492GCTGTGAATTGTGTTGTAATCC457
CTTGACTCTTCAAAAGAGAAAATTACGCTGTGAACTTTGTTGTAATCC
LTGGCGACAGATTATACCGTGC581GCGAGAGGAACACAAACCGG581
CCGAATTCTGTTATATATGTC
EPECeaeb
EAFCAGGGTAAAAGAAAGATGATAA214TATGGGGACCATGTATTATCA313
TATGGGGACCATGTATTATCA
BFPAATGGTGCTTGCGCTTGCTGC268GCTACGGTGTTAATATCTCTGGCG462
GCCGCTTTATCCAACCTGGTA
EHECeaeCAGGTCGTCGTGTCTGCTAAA234ACTGAAAGCAAGCGGTGGTG691
TCAGCGTGGTTGGATCAACCT (O157:H7-specific)
SLTITTTACGATAGACTTCTCGAC223GATGATCTCAGTGGGCGTTC270
CACATATAAATTATTTCGCTC (SLT-I AND II)
SLTIIAs aboveTCTGAAACTGCTCCTGTGTA270
PlasmidACGATGTGGTTTATTCTGGA223CCGTATCTTATAATAAGACGGATGTTGG223
CTTCACGTCACCATACATAT
EIECialCTGGATGGTATGGTGAGG579CCATCTATTAGAATACCTGTG579
GGAGGCCAACAATTATTTCC
EAECPlasmidCTGGCGAAAGACTGTATCAT576None
CAATGTATAGAAATCCGCTGTT
  • a Each primer is written 5′-3′. See the text for abbreviations and discussion.

  • b No oligonucleotide primers have yet been described which will detect specifically all human EPEC strains. (See reference 234.)