Table 2.

Nucleotide sequences of PCR oligonucleotide primers and oligonucleotide probes for diarrheagenic E. coli strains

CategoryFactorPCR oligonucleotidesaReferenceOligonucleotide probeReference
ETECSTITTAATAGCACCCGGTACAAGCAGG 492 GCTGTGAATTGTGTTGTAATCC 457
CTTGACTCTTCAAAAGAGAAAATTACGCTGTGAACTTTGTTGTAATCC
LTGGCGACAGATTATACCGTGC 581 GCGAGAGGAACACAAACCGG 581
CCGAATTCTGTTATATATGTC
EPECeaeb
EAFCAGGGTAAAAGAAAGATGATAA 214 TATGGGGACCATGTATTATCA 313
TATGGGGACCATGTATTATCA
BFPAATGGTGCTTGCGCTTGCTGC 268 GCTACGGTGTTAATATCTCTGGCG 462
GCCGCTTTATCCAACCTGGTA
EHECeaeCAGGTCGTCGTGTCTGCTAAA 234 ACTGAAAGCAAGCGGTGGTG 691
TCAGCGTGGTTGGATCAACCT (O157:H7-specific)
SLTITTTACGATAGACTTCTCGAC 223 GATGATCTCAGTGGGCGTTC 270
CACATATAAATTATTTCGCTC (SLT-I AND II)
SLTIIAs aboveTCTGAAACTGCTCCTGTGTA 270
PlasmidACGATGTGGTTTATTCTGGA 223 CCGTATCTTATAATAAGACGGATGTTGG 223
CTTCACGTCACCATACATAT
EIECialCTGGATGGTATGGTGAGG 579 CCATCTATTAGAATACCTGTG 579
GGAGGCCAACAATTATTTCC
EAECPlasmidCTGGCGAAAGACTGTATCAT 576 None
CAATGTATAGAAATCCGCTGTT
  • a Each primer is written 5′-3′. See the text for abbreviations and discussion.

  • b No oligonucleotide primers have yet been described which will detect specifically all human EPEC strains. (See reference 234.)