TABLE 9

Primers and targets used to detect Plesiomonas shigelloides in environmental and clinical specimens by PCR and LAMP assays

Target geneMethodaPrimer or probe sequence (5′–3′)PCR product size (bp)Reference(s)
23S rRNACForward (PS23FW3), CTCCGAATACCGTAGAGTGCTATCC284 42
Reverse (PS23RV3), CTCCCCTAGCCCAATAACACCTAAA
23S rRNARTForward, AGCGCCTCGGACGAACACCTA112 221
Reverse, GTGTCTCCCGGATAGCAC
LCRed640, GGTAGAGCACTGTTAAGGCTAGGGGGTCATC-P
23S rRNACForward (PS-F), GCAGGTTGAAGGTTGGGTAA628 222
Reverse (PS-R), TTGAACAGGAACCCTTGGTC
gyrB SYForward (237-F), TTCCAGTACGAGATCCTGGCTAA68 223, 224
Reverse (304-R), TGAATCGACACGCCAGAGTTC
hugA CForward, GCGAGCGGGAAGGGAAGAACC435 51
Reverse, GTCGCCCCAAACGCTAACTCATCA
hugA LAF3, AACACGTTGCAGCCCATC 225
B3, ACTTTACCGCCGAAGACAAG
FIP, CGTTACGACGAAGCGTTCCGTGAAGTGAGTACCGGTGGTGT b
BIP, GTCAGCCAATCAGTCGCCGCAATATCGCCGGCTCCGAG c
LF- ACCGAGCATGGAAGAGATGT
LB, GCGACAGGTGATCTTCGCTAC
hugA RTForward, GGAATATCGGCCTGTACAT116 225
Reverse, TATGGCGGCGATATTTA
Probe, FAM-CCCCAGACTTTGCTGCGACCATCGG-BHQ-1
  • a Abbreviations: C, conventional PCR; RT, real-time PCR using hybridization probes; SY, real-time PCR using SYBR green stain; LA, loop-mediated isothermal amplification; FAM, 6-carboxyfluorescein; BHQ-1, Black Hole quencher 1.

  • b FIP, forward inner primer. The sequence for target recognition is underlined, and the sequence for loop formation is not underlined.

  • c BIP, backward inner primer. The sequence for target recognition is underlined, and the sequence for loop formation is not underlined.