TABLE 5

Primers and probes used for ZIKV detection by RT-PCR

RT-PCR target and primerSequenceGene productPositionAmplicon size (bp)Reference
Flavivirus
    Uni forTGGGGNAAYSRNTGYGGNYTNTTYGGE Va 341
    Uni revCCNCCHRNNGANCCRAARTCCCA
    DJSGACATGGGGTATTGGATNS1 V 342
    DJATCCATCCCATACCTGCA
    DV1GGRACKTCAGGWTCTCCNS3 V 343
    DV3AARTGIGCYTCRTCCAT
    cFD2GTGTCCCAGCCGGCGGTGTCATCAGCNS5 V 47
    MACATGATGGGRAARAGRGARRAG
    FG1TCAAGGAACTCCACACATGAGATGTACTNS5 V 344
    FG2TGTATGCTGATGACACAGCAGGATGGGACAC
    Flav100FAAYTCIACICAIGARATGTAYNS5 V 346
    Flav200FCCIARCCACATRWACCA
    VD8GGGTCTCCTCTAACCTCTAGNS5 V 345
    EMF1TGGATGACACGAGAATG
    MAMDAACATGATGGGRAARAGRGARAANS5 V 347
    cFD2GTGTCCCAGCCGGCGGTGTCATCAGC
ZIKV
    ZIKV835TTGGTCATGATACTGCTGATTGCM/E835-85776 135
    ZIKV911cCCTTCCACAAAGTCCCTATTGC911-890
    ZIKV860FAMCGGCATACAGCATCAGGTGCATAGGAG860-886
    ZIKV1086CCGCTGCCCAACACAAGpE1086-110276 135
    ZIKV1162cCCACTAACGTTCTTTTGCAGACAT1162-1139
    ZIKV1107FAMAGCCTACCTTGACAAGCAGTCAGACACTCAA1107-1137
    ZIKVENVFGCTGGDGCRGACACHGGRACTE1538-1558364 350
    ZIKVENVRRTCYACYGCCATYTGGRCTG1902-1883
    ZIKVF9027aCCTTGGATTCTTGAACGAGGANS59121-9141192 351
    ZIKVR9197caAGAGCTTCATTCTCCAGATCAA9312-9290
    ForwardAARTACACATACCARAACAAAGTGGTNS59271-9297102 8
    ReverseTCCRCTCCCYCTYTGGTCTTG9352-9373
    ProbeFAMCTYAGACCAGCTGAAR9304-9320
  • a V, variable in the different flaviviruses.