TABLE 7.

Target, primer, assay type, and main use of some commonly used G. duodenalis genotyping tools

GenePrimer (sequence [5′-3′])Size (bp)SpecificityAssay typeUsage(s)References
tpi AL3543 (AAATIATGCCTGCTCGTCG)605Genus specifica Nested PCR, sequencingGenotyping and subtyping 4, 13, 32, 37, 59, 78, 83, 87, 93, 145, 154, 225, 249, 263, 300
AL3546 (CAAACCTTITCCGCAAACC)
AL3544 (CCCTTCATCGGIGGTAACTT)532
AL3545 (GTGGCCACCACICCCGTGCC)
gdh Ghd1 (TTCCGTRTYCAGTACAACTC)754Genus specificNested PCR,Genotyping and 37, 145, 154, 156
Gdh2 (ACCTCGTTCTGRGTGGCGCA)    sequencing    subtyping
Gdh3 (ATGACYGAGCTYCAGAGGCACGT)530
Gdh4 (GTGGCGCARGGCATGATGCA)
gdh GDH1 (ATCTTCGAGAGGATGCTTGAG)778Genus specificPCR, RFLP sequencingGenotyping and subtyping 3, 4, 93, 116, 130, 170, 282
GDH4 (AGTACGCGACGCTGGGATACT)
gdh GDHeF (TCAACGTYAAYCGYGGYTTCCGT)432Genus specificSeminested PCR, RFLPGenotyping and subtyping 31, 48, 86, 109, 128, 154, 202, 214, 218, 223, 300
GDHiF (CAGTACAACTCYGCTCTCGG)
GDHiR (GTTRTCCTTGCACATCTCC)
SSU rRNA geneRH11 (CATCCGGTCGATCCTGCC)292Genus specificPCR, sequencingGenotyping 3, 4, 37, 77, 118, 148, 164, 196, 213, 231, 255, 264, 270, 300
RH4 (AGTCGAACCCTGATTCTCCGCCCAGG)
GiarF (GACGCTCTCCCCAAGGAC)130
GiarR (CTGCGTCACGCTGCTCG)
bg G7 (AAGCCCGACGACCTCACCCGCAGTGC)753UnknownNested PCR, sequencingGenotyping and subtyping 4, 37, 39, 87, 92, 98, 146, 148, 153, 154, 156, 170, 196, 202, 217, 287, 288
G759 (GAGGCCGCCCTGGATCTTCGAGACGAC)
GiarF (GAACGAACGAGATCGAGGTCCG)
GiarR (CTCGACGAGCTTCGTGTT)511
  • a Does not amplify assemblage D (154).